View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_low_30 (Length: 330)
Name: NF1292_low_30
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 96 - 313
Target Start/End: Complemental strand, 52797536 - 52797319
Alignment:
| Q |
96 |
atggaagactctctatgtccttttcttccattttcctatcagagcttattttgctccttagttccatttgcactttcaatagggttcttgggttgtgcag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52797536 |
atggaagactctctatgtccttttcttccattttcctatcagagcttattttgctccttagttccatttgcacttttgatagggttcttgggttgtgcag |
52797437 |
T |
 |
| Q |
196 |
aagctccgccatcgcccattctagtgtgcttgttgtcgtgtctgtccctgcagtgaacatttcctacaacacaataatattactatcaatgtcacaaact |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52797436 |
aagctccgccatcgcccattctagtgtgcttgttgtcgtgtctgtccctgcagtgaacatttcctacaacacaataatattactatcaatgtcacaaact |
52797337 |
T |
 |
| Q |
296 |
gccatgattcttctctct |
313 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52797336 |
gccatgattcttctctct |
52797319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University