View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_low_33 (Length: 318)
Name: NF1292_low_33
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 174 - 299
Target Start/End: Complemental strand, 40549113 - 40548988
Alignment:
| Q |
174 |
catttataccaaaatttatgtaccaaaaaatatgcaccactttttatgtaaagttgcatgtttcgttctattctaacatctgtactacatacggtacaat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40549113 |
catttataccaaaatttatgtaccaaaaaatatgcaccactttttatgtaaagttgcatgtttcgttctattctaacatctgtactacatacggtacaat |
40549014 |
T |
 |
| Q |
274 |
cgattgaggatgtgacaaattattgc |
299 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40549013 |
cgattgaggatgtgacaaattattgc |
40548988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University