View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_low_36 (Length: 272)
Name: NF1292_low_36
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_low_36 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 27 - 272
Target Start/End: Original strand, 31456091 - 31456336
Alignment:
| Q |
27 |
agtatatagctttggctcaatattaccagcaactatattttagtttaaaatacaattaaattcaattaataaactcttagatnnnnnnnnttaactcaat |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31456091 |
agtatatagctttggctcaatattaccagctactatattttagtttaaaatacaattaaattcaattaataaactcttagataaaaaaaattaactcaat |
31456190 |
T |
 |
| Q |
127 |
tgtttagatactatggaggaaccttgatgttggttggataaatgtaaacacaaatggttctgcagttggcaattcctccatagttgcaagtggttctatt |
226 |
Q |
| |
|
||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31456191 |
tgtgtagatactatggaggaaccttgatattggatggataaatgtaaacacaaatggttctgcagttggcaattcctccatagttgcaagtggttctatt |
31456290 |
T |
 |
| Q |
227 |
ttcagagattctagagaagcttttgtgacttgcttttcaatgaaca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31456291 |
ttcagagattctagagaagcttttgtgacttgcttttcaatgaaca |
31456336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University