View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_low_39 (Length: 251)
Name: NF1292_low_39
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_low_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 33512341 - 33512101
Alignment:
| Q |
1 |
caattcctgaaaatcttgatcttgatctcataagcgttgctaattgattatttggatcatcacttataggaagtaattgtctacggtgacatactttggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33512341 |
caattcctgaaaatcttgatcttgatctcataagtgttgctaattgattatttggatcatcacttataggaagtaattgtctacggtgacatactttggc |
33512242 |
T |
 |
| Q |
101 |
aaaaataagaagaatgaatgttaaagaaaacatgagacctaggattgctatgacaacaacaagacttggttggaaatttgaaacagcatcttgtgaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33512241 |
aaaaataagaagaatgaatgttaaggaaaacatgagacctaggattgctatgacaacaacaagacttggttggaaatttgaaacagcatcttgtgaattt |
33512142 |
T |
 |
| Q |
201 |
gtagtttgtgttggtgattgagctctaatatggaagaataa |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33512141 |
gtagtttgtgttggtgattgagctctaatatggaagaataa |
33512101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University