View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_low_4 (Length: 577)
Name: NF1292_low_4
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 4e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 74 - 290
Target Start/End: Complemental strand, 31928748 - 31928538
Alignment:
| Q |
74 |
aatgtgaacaaattcaactgaccaatattctgtaaccaacggttattgagagaacatgcaaagggggatataactagcactaaagattaacggttccaag |
173 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||| ||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
31928748 |
aatgtgaacaaattccactgaccaata-------accaacggttattgagataacatgcaatgggatatataactagcactaaggattaacggttccaag |
31928656 |
T |
 |
| Q |
174 |
caaa-tttgcaacaataacaaaagttgcagctcaaaagtggacccagtatagcaaaacaaccgatgatattgtatattgtaatggaaattttcgacttta |
272 |
Q |
| |
|
|||| ||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| ||||||||||| |||||||||||||||| | |||||| |
|
|
| T |
31928655 |
caaaatttgcaataataacaaaagttgcagttcaaaagtagacccagtatagcaaaggaaccaatgatattgtaaattgtaatggaaatttccaacttta |
31928556 |
T |
 |
| Q |
273 |
attgattattcctttttt |
290 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
31928555 |
attgataattcctttttt |
31928538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 487 - 564
Target Start/End: Complemental strand, 31928398 - 31928319
Alignment:
| Q |
487 |
tatttaggtattttgggttaga--gttaatgaattaaggtttagccataagtctcctttttatggggaattattagggtt |
564 |
Q |
| |
|
||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31928398 |
tatttaggtattttggggtagaaagtgaatgaattaaggtttagccataagtctcctttttatggggaagtattagggtt |
31928319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University