View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_low_41 (Length: 251)
Name: NF1292_low_41
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 56 - 240
Target Start/End: Complemental strand, 119815 - 119631
Alignment:
| Q |
56 |
gacaccttctgaaatctttacagttactttattttgaaagaagcatatatccaccaatgataactcatttaactggatttattgattttgatgtttactt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
119815 |
gacaccttctgaaatctttacagttactttattttgaaagaagcatatatccaccaatgataactcatttaactggatttattgattttgatgtttactt |
119716 |
T |
|
| Q |
156 |
acatgacctttgaaaataatagttgtctgttaaaatgagctcttgatgagtaagtaaggtgaagtattgtaattttgaagttcat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
119715 |
acatgacctttgaaaataatagttgtctgttaaaatgagctattgatgagtaagtaaggtgaagtattgtaattttgaagttcat |
119631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 119859 - 119829
Alignment:
| Q |
1 |
tatttgtatatatccaagtattttattgtgg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
119859 |
tatttgtatatatccaagtattttattgtgg |
119829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University