View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_low_47 (Length: 237)
Name: NF1292_low_47
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 38 - 116
Target Start/End: Complemental strand, 7645341 - 7645263
Alignment:
| Q |
38 |
tctttttcgtaagtgaattgcaatccaaaaattgtttttcaagtcttcccaatataaacggtggttaaaccctcttttg |
116 |
Q |
| |
|
|||| ||||||||||||| ||||| ||||||||||| || |||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
7645341 |
tcttattcgtaagtgaatggcaatacaaaaattgttattacagtcttaccaatataaacggtggttaaacactcttttg |
7645263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 175
Target Start/End: Complemental strand, 7645247 - 7645207
Alignment:
| Q |
135 |
ctcaaaaggctttcacttttgtgattatagaaatgaacaca |
175 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7645247 |
ctcaaaaggctttcactttgatgattatagaaatgaacaca |
7645207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University