View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1292_low_48 (Length: 232)
Name: NF1292_low_48
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1292_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 35409851 - 35410051
Alignment:
| Q |
19 |
tcaggggtgtttagtttaggccaccaggtagcatttttatgatcagggtgccccatgttgatgaattctttgtaccaggactggagttcattgtcagaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409851 |
tcaggggtgtttagtttaggccaccaggtagcatttttatgatcagggtgccccatgttgatgaattctttgtaccaggactggagttcattgtcagaag |
35409950 |
T |
 |
| Q |
119 |
aaacggcattcaaatctttgtagtaatggttcacataggtcctgaccaacttctctatactagtccatatgaggagtccatcagccgcataaggattatc |
218 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35409951 |
aaatggcattcaaatctttgtagtaatggttcacataggtcctgaccaacttctctatactagaccatatgaggagtccatcagccgcataaggataatc |
35410050 |
T |
 |
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
35410051 |
t |
35410051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University