View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1292_low_56 (Length: 201)

Name: NF1292_low_56
Description: NF1292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1292_low_56
NF1292_low_56
[»] chr4 (1 HSPs)
chr4 (1-104)||(27888542-27888645)


Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 27888645 - 27888542
Alignment:
1 tttgaaacaatccttgtctagaagaaggaattttatatttagttttctttttagccattatcttaatagtaatatttcagtagatgagatggggagttag 100  Q
    |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27888645 tttgaaacaatccttgcccagaagaaggaattttatatttagttttctttttagccattatcttaatagtaatatttcagtagatgagatggggagttag 27888546  T
101 gttg 104  Q
    ||||    
27888545 gttg 27888542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University