View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1293-Insertion-3 (Length: 191)
Name: NF1293-Insertion-3
Description: NF1293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1293-Insertion-3 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 11743042 - 11743225
Alignment:
| Q |
8 |
tatccatcccttcttgatcatattgacttcttgcggccaaaaatgaagtttctgaatgagtccgtacactgcacaagtcaataaatgcaccttccatttc |
107 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11743042 |
tatccatccctccttgatcatattaacttcttgcggccaaaaatgaagtttctgaatgagtccgtacactgcacaagtcaataaatgcaccttccatttc |
11743141 |
T |
 |
| Q |
108 |
cattaatgctttcttttcatctcagtctttccctttgacatatctcagaacgtcactgtatgtgttgttgattcattgctccaa |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11743142 |
cattaatgctttcttttcatctcagtctttccctttgacatatctcagaacgtcactgtatgtgttgttgattcattgctccaa |
11743225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University