View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12930_high_29 (Length: 219)
Name: NF12930_high_29
Description: NF12930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12930_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 37173276 - 37173479
Alignment:
| Q |
1 |
tgcagtccaaaaggttatgtctattataggaacatattcacattttctatacaaagaagtttatcatagagatgaacagtgtattcctcagtgctttgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173276 |
tgcagtccaaaaggttatgtctattataggaacatattcacattttctatacaaagaagtttatcatagagatgaacagtgtattcctcagtgctttgca |
37173375 |
T |
|
| Q |
101 |
agtggcagggattctctgttatgtcgcaagagttgttttgggaacataataaggattgaaaaacaaaagaagattagaaggaagaatttacgtgtggaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173376 |
agtggcagggattctctgttatgtcgcaagagttgttttgggaacataataaggattgaaaaacaaaagaagattagaaggaagaatttacgtgtggaag |
37173475 |
T |
|
| Q |
201 |
ctat |
204 |
Q |
| |
|
|||| |
|
|
| T |
37173476 |
ctat |
37173479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University