View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12930_low_6 (Length: 566)
Name: NF12930_low_6
Description: NF12930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12930_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 4e-58; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 432 - 550
Target Start/End: Complemental strand, 24850489 - 24850371
Alignment:
| Q |
432 |
gacaacgcactcaaggttagtgttgatgacgtgaacaatggagaatatgctctgaaggtgacgactgtgaaggcaaataacacaacggcggagcaggcac |
531 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24850489 |
gacaaggcactcaaggttagtgttgatgacgtgaacaatggagaatatgctctgaaggtgacgactgtgaaggcaaataacacaacggcggagcaggcac |
24850390 |
T |
|
| Q |
532 |
acactgcagctgtgctgtt |
550 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24850389 |
acactgcagctgtgctgtt |
24850371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 336 - 433
Target Start/End: Complemental strand, 24850633 - 24850536
Alignment:
| Q |
336 |
gttataaaggaaatgactctcaatatcgaaactcaaaaacacaactttcttggataagctttcttgcgaattaatttttattaatcttatccaggtga |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24850633 |
gttataaaggaaatgactctcaatatcgaaactcaaaaacacaactttcttggataagctttcttgcgaattaatttttattaatcttatccaggtga |
24850536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 25 - 61
Target Start/End: Complemental strand, 24823806 - 24823770
Alignment:
| Q |
25 |
tatcgagaatggcctccaatggtagtgatgaacgaga |
61 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
24823806 |
tatcaagaatggcctccaatggtagtgatggacgaga |
24823770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University