View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12931_high_44 (Length: 250)
Name: NF12931_high_44
Description: NF12931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12931_high_44 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 3884183 - 3883940
Alignment:
| Q |
7 |
gtgaaatgaaaggtaagtaccaaggtatactatagataagaattaatctttaagttacctttagattgtacacaagtttatcagtctcaacatcaattat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884183 |
gtgaaatgaaaggtaagtaccaaggtatactatagataagaattaatctttaagttacctttagattgtacacaagtttatcagtctcaacatcaattat |
3884084 |
T |
|
| Q |
107 |
tttgagattatttccagtagcagtagctagaagcatgccaaggggctggaatctaacttgtttactacctccctgcaatatgttattatcattaatcggc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884083 |
tttgagattatttccagtagcagtagctagaagcatgccaagaggctggaatctaacttgtttactacctccctgcaatatgttattatcattaatcggc |
3883984 |
T |
|
| Q |
207 |
ttcctgttttcatagcagatgtttaagcatgtgaatgagtacat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3883983 |
ttcctgttttcatagcagatgtttaagcatgtgaatgagaacat |
3883940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University