View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12931_high_47 (Length: 248)
Name: NF12931_high_47
Description: NF12931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12931_high_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 237
Target Start/End: Original strand, 35273847 - 35274069
Alignment:
| Q |
15 |
tgatgaatcttcaaagagaagctcaatttttcaagggacagtatctgctctatctgatccttctcatcatccatggcgtatgcttcaggtatatatgatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35273847 |
tgatgaatcttcaaagagaagctcaatttttcaagggacagtatctgctctatctgatccttctcatcatccatggcgtatgcttcaggtatatatgatt |
35273946 |
T |
 |
| Q |
115 |
tcttcttttggtgtatattatttcaaatgcatataatgttatgtagtatatttttgttccataaatgttgttacagttgaagttgatagataactttcca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35273947 |
tcttcttttggtgtatattatttcaaatgcatataatgttatgtcgtatatttttgttccataaatgttgttacagttgaagttgatagataactttcca |
35274046 |
T |
 |
| Q |
215 |
taattagataatgcatggttcat |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35274047 |
taattagataatgcatggttcat |
35274069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University