View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12931_low_36 (Length: 321)
Name: NF12931_low_36
Description: NF12931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12931_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 39092668 - 39092358
Alignment:
| Q |
1 |
aggagcgccaaatcccctttcctttctttcccttacctcagtttctagatttcaattctacacttcactgtaaaccctaaaatctcgaatccaattagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39092668 |
aggagcgccaaatcccctttcctttctttcccttacctcagtttctagatttcaattctacacttcactgtaaaccctaaaatctcgaatccaattagat |
39092569 |
T |
 |
| Q |
101 |
tgaaattcgaaaatgaaaggtggaacggttcagattaattggcacgagagcaaacccgttttaaccctagattttcaccctctctcctccactctcgcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39092568 |
tgaaattcgaaaatgaaaggtggaacggttcagattaattggcacgagagcaaacccgttttaaccctagattttcatcctctctcctccactctcgcca |
39092469 |
T |
 |
| Q |
201 |
ccgccggcgctgatttcgacatcaaggtactcttcactggtcattcactcacatcattcaattaattagttaatcaataatcaaatcaagattacattga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||| |
|
|
| T |
39092468 |
ccgccggcgctgatttcgacatcaaggtactcttcactgttccttcactcacatcattcaattaattagttaattaatcatcaaattaagattacattga |
39092369 |
T |
 |
| Q |
301 |
attgatctgtg |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
39092368 |
attgatctgtg |
39092358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University