View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12931_low_38 (Length: 317)
Name: NF12931_low_38
Description: NF12931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12931_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 310
Target Start/End: Original strand, 6585569 - 6585865
Alignment:
| Q |
17 |
atgaaacccgatatgttattgttttttgnnnnnnnnnnnttgtggaaacactg---cagcaaccaagagagccattgcactctgcatcttacaagagcat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6585569 |
atgaaacccgatatgttattgttttttgaaaaataaaa-ttgtggaaacactgaaacaccaaccaagagagccattgcactctgcatcttacaagagcat |
6585667 |
T |
|
| Q |
114 |
atatcacccctaagta-ttgttcaaataaaagaccaaatgagtaatacgtgacacttttgtaataaaacccattgctagaacagttgagacttacagtaa |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6585668 |
atatcacccctaagtaattgttcaaataaaagaccaaatgagtaatacgtgacacttttgtaataaaacccattgctagaacagttgagacttacagtaa |
6585767 |
T |
|
| Q |
213 |
aggtatgttgttgtttagctgcaccatagctttcctttacaaccctcccagcaacagttctgcttcctctaactcttccatgcctagcccctttgcta |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6585768 |
aggtatgttgttgtttagctgcaccatagctttcctttacaaccctcccagcaacagttctgcttcctctaactcttccatgcctagcccctttgcta |
6585865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 7854782 - 7854742
Alignment:
| Q |
206 |
acagtaaaggtatgttgttgtttagctgcaccatagctttc |
246 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||||||||||| |
|
|
| T |
7854782 |
acagtaaatgtatgctgttgtttagcagcaccatagctttc |
7854742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University