View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12931_low_55 (Length: 239)
Name: NF12931_low_55
Description: NF12931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12931_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 219
Target Start/End: Complemental strand, 33253204 - 33252999
Alignment:
| Q |
14 |
cacagataccctcacaccctagaaaattggttaaaaacacgactagcaagtaacaagaaaaaatagggcagacaatgatatttttatccaaaagagtgga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33253204 |
cacagataccctcacaccctagaaaattggttaaaaacacgactagcaagtaacaagaaaaaatagggcagacgatgatatttttatccaaaagagtgga |
33253105 |
T |
 |
| Q |
114 |
tagtggggactgctacacatgttcataggaactagtaaacatcaagaaccgtactcagcatatcatcaaactctaaaattattcacacacataatgcggc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33253104 |
tagtggggactgctacacatgttcataggaaccggtaaacatcaataaccgtactcagcatatcatcaaactctaaaattattcacacacataatgcggc |
33253005 |
T |
 |
| Q |
214 |
tctatt |
219 |
Q |
| |
|
|||||| |
|
|
| T |
33253004 |
tctatt |
33252999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University