View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12931_low_58 (Length: 237)
Name: NF12931_low_58
Description: NF12931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12931_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 221
Target Start/End: Complemental strand, 3883491 - 3883290
Alignment:
| Q |
22 |
tcaactattaaatttgccacaa--tgcaatggaagaagaaggtgaatgaacgtgcaaataggaaaggagagataaaagtgaagggaagcgggaaatgatc |
119 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3883491 |
tcaactattaaatttgccacaaaatgcaatggaagaagaaggtgaatgaacgtgcaaataggaaaggagagataaaagtgaagggaagcgggaaatgatc |
3883392 |
T |
 |
| Q |
120 |
catattcttaacagttggaagctatgaatatacatgaagacaatcaggacaaaaagaaagtgaccagtaacagcttaccttggttgtatcccatagtctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3883391 |
catattcttaacagttggaagctatgaatatacatgaagacaatcaggacaaaaagaaagtgaccagtaacagcttaccttggttgtatcccatagtctt |
3883292 |
T |
 |
| Q |
220 |
at |
221 |
Q |
| |
|
|| |
|
|
| T |
3883291 |
at |
3883290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University