View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12932_high_10 (Length: 275)
Name: NF12932_high_10
Description: NF12932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12932_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 26939207 - 26939408
Alignment:
| Q |
17 |
agagggtggttgagagaccttgagggaaggaagagagggaaagagacaaccccatttggattgagagagaattgtgatcatgtggatggatgagatnnnn |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26939207 |
agagagtggttgagagaccttgagggaaggaagagagggaaagtgacaaccccatttggattgagagagaattgtgatcatgtggatggatgagat--ag |
26939304 |
T |
|
| Q |
117 |
nnnnnnnnnttctaagtattaattggtagcgctattggttccctcttatacgttactattactttgaccatatttttgcattgctccacattgtgcattt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
26939305 |
agagagagattctaagtattaattggtagcgctattggttccctcttatacg-tactattgctttgaccatatttttgcattgcttcaca-tgtgcattt |
26939402 |
T |
|
| Q |
217 |
tatttt |
222 |
Q |
| |
|
| |||| |
|
|
| T |
26939403 |
tttttt |
26939408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 208 - 261
Target Start/End: Original strand, 26939423 - 26939476
Alignment:
| Q |
208 |
tgtgcattttattttattttcttgaaatgctaacttgtgccgttttggttcatc |
261 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26939423 |
tgtgcattttattttattttcttgaaacgctaacttgtgccgttttggttcatc |
26939476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University