View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12932_high_13 (Length: 253)
Name: NF12932_high_13
Description: NF12932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12932_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 7 - 183
Target Start/End: Complemental strand, 34883499 - 34883324
Alignment:
| Q |
7 |
tggaagttaaacaacaatgagatggaaagaggataagaagccacgtaatatgcatgtaaatcacaaactcagtcatgaatgatccttgtctaaggaaaat |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34883499 |
tggaaattaaacaacaatgagatggaaagaggataagaagccacgtaatatgcatgtaaatcacaaactcactcatgaatgatccttgtctaaggaaaat |
34883400 |
T |
|
| Q |
107 |
ccaacggtgacaagtattactatgttcctagatagactagactagattttgtaggtagtaaaacaaggtaacagtag |
183 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34883399 |
ccaacggtgac-agtattactatgttcctagatagactagactagattttgtaggtagcaaaacaaggtaacagtag |
34883324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 237
Target Start/End: Complemental strand, 34883302 - 34883267
Alignment:
| Q |
202 |
gtcttgctgagtgaagatgaccaattttgttggact |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34883302 |
gtcttgctgagtgaagatgaccaattttgttggact |
34883267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University