View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12932_high_20 (Length: 225)

Name: NF12932_high_20
Description: NF12932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12932_high_20
NF12932_high_20
[»] chr2 (1 HSPs)
chr2 (1-218)||(45171031-45171245)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 45171031 - 45171245
Alignment:
1 aagacaaatattcttcgacatccggataaaaaattaaacaactttcatagcaataaatggttatattaagactaatattgcagcagatttagctggatac 100  Q
    ||||||||||||  |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45171031 aagacaaatattggtcgatatccggataaaaaattaaacaactttcatagcaataaatggttatattaagactaatattgcagcagatttagctggatac 45171130  T
101 caacatgcaatgaaaaaatcttgtgaacaagaatgaacagaaataaatctacaagatgttagagcctagtggtgtttcgcagtgaggacgttttatgcgg 200  Q
    |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||    
45171131 caacatgcaacgaaaaaatcttgtgaacaagaattaacagaaataaatctacaagatgttagagccta---gtgtttcgcagtgaggacgttttatgcgg 45171227  T
201 gtgtctgggtttgatcct 218  Q
    ||||||||||||||||||    
45171228 gtgtctgggtttgatcct 45171245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University