View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12932_low_10 (Length: 326)
Name: NF12932_low_10
Description: NF12932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12932_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 77 - 308
Target Start/End: Original strand, 48967085 - 48967316
Alignment:
| Q |
77 |
ttcttcaatacattatgattcatattcataattataagtcccagctccaataccaacatcatctaaatcttgttggctgcttcagagcttcatctctcta |
176 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48967085 |
ttcttcaacacattatgattcatattcataattataagtcccagctccaataccaacatcatctaaatcttgttggctgcttcagagcttcatctctcta |
48967184 |
T |
|
| Q |
177 |
atcacactttaggtagtatacacaatttttgtatgatcggtgaacgcaacacaattgttgttgtaattataccatgaatcataatgcgttcaccgatcat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48967185 |
atcacactttaggtagtatacacaatttttgtatgatcggtgaacgcaacacaattgttgttgtaattataccatgaatcataatgcgttcaccgatcat |
48967284 |
T |
|
| Q |
277 |
tcttttctaataatttgaagatttgagaccag |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48967285 |
tcttttctaataatttgaagatttgagaccag |
48967316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University