View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12932_low_15 (Length: 254)
Name: NF12932_low_15
Description: NF12932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12932_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 46247963 - 46247717
Alignment:
| Q |
1 |
ggttgcccttttttactagttgattatatgtagctgttttcttgatatgaatatcaattcgtgcaagggtagattggaagaaagattttgtgtctaagac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46247963 |
ggttgcccttttttactagttgattatatgtggctgttttcttgatatgaatatcaattcgtgcaagggtagattggaagaaagattttgtgtctaagac |
46247864 |
T |
|
| Q |
101 |
aatatttggaaattgttttattgtttcactgttgaatgcactgatgtaggatcatatagtgcggggaagtattgacctgagccaactaaagtttcgtgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46247863 |
aatatttggaaattgttttattgtttcactgttgaatgcactgatgtaggatcatatagtgcggggaagtattgacctgagccaactaaagtttcgtgtt |
46247764 |
T |
|
| Q |
201 |
ctcgatgaagcagatgagatgctgaggatgggttttgttgatgatgt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46247763 |
ctcgatgaagcagatgagatgctgaggatgggttttgttgaagatgt |
46247717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 147 - 247
Target Start/End: Complemental strand, 20122974 - 20122874
Alignment:
| Q |
147 |
taggatcatatagtgcggggaagtattgacctgagccaactaaagtttcgtgtcctcgatgaagcagatgagatgctgaggatgggttttgttgatgatg |
246 |
Q |
| |
|
||||||||||| | | |||| | ||||||||||||||| || ||||| |||||||| || || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20122974 |
taggatcatatcgagagggggaatattgacctgagccacctgaagttccgtgtccttgacgaggcagatgagatgttgaggatgggttttgttgatgatg |
20122875 |
T |
|
| Q |
247 |
t |
247 |
Q |
| |
|
| |
|
|
| T |
20122874 |
t |
20122874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University