View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12932_low_17 (Length: 251)
Name: NF12932_low_17
Description: NF12932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12932_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 65 - 235
Target Start/End: Complemental strand, 45342084 - 45341914
Alignment:
| Q |
65 |
atgattgaatcgttgtttcagtgtagtggtgttgttatgctattttttcggttatgtgcgtatgtatgtttgttgaatcgtatattgaacatttgtttgt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342084 |
atgattgaatcgttgtttcagtgtagtggtgttgttatgctattttttcggttatgtgcgtatgtatgtttgttgaatcgtatattgaacatttgtttgt |
45341985 |
T |
 |
| Q |
165 |
ttttgtcgttatgcgtaccgttactacaggattgggatttggtggtggtggtggggctcgtactggaacgt |
235 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341984 |
ttttgtcgttatgcgtaccgttattacaggattgggatttggtggtggtggtggggctcgtactggaacgt |
45341914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 17 - 70
Target Start/End: Complemental strand, 45342169 - 45342116
Alignment:
| Q |
17 |
ttctctttccaaaaatcactgttaatttgtagattcattgctattgctatgatt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342169 |
ttctctttccaaaaatcactgttaatttgtagattcattgctattgctatgatt |
45342116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University