View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12932_low_18 (Length: 250)
Name: NF12932_low_18
Description: NF12932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12932_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 34353992 - 34354234
Alignment:
| Q |
1 |
tggagtttgtcacgataatggagcttctcattttctacaatttgggtatgaaattagtggtgaaagatacataagagttagatttttcatttggccattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34353992 |
tggagtttgtcacgataatggagcttctcattttctacaatttgggtatgaaattagtggtgaaagatacacaagagttagatttttcatttggccattg |
34354091 |
T |
 |
| Q |
101 |
tgatcttggatatagaacgattcttaaggggtaagtggtggattatcaagaggtggaagcaaaagataaaatcagtgtttttggttcattttaagaaagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34354092 |
tgatcttggatatagaacgattcttaaggggtatgtggtggattatcaagacgtggaagcaaaagataaaatcagtgtttttggttcattttaagaaagg |
34354191 |
T |
 |
| Q |
201 |
ctaaagcctcattttgaagtattttttattggtgttcatatca |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34354192 |
ctaaagcctcattttgaagtattttttattggtgttcttatca |
34354234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University