View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12932_low_20 (Length: 242)
Name: NF12932_low_20
Description: NF12932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12932_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 34 - 237
Target Start/End: Original strand, 47294095 - 47294298
Alignment:
| Q |
34 |
atttgtatttagacaaagacttttagacaaggaaatatttctctttcgtccttttcattaaactaaagatgcagagcttgtaattagtttataattgcag |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47294095 |
atttgtatttagacaaagacttttagacaaggaaatatttctctttcgtccttttcattaaactaaagatgcagagcttgtaattagtttataattgcag |
47294194 |
T |
|
| Q |
134 |
gcaattgtttttctttgggtgtataatccaaatatttatatatacactaataattattaaatgatggaatttgttccannnnnnnacttgaatatcccta |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47294195 |
gcaattgtttttctttgggtgtataatccaaatatttatatatacactaatcattattaaatgatggaatttgttccatttttttacttgaatatccctt |
47294294 |
T |
|
| Q |
234 |
tgct |
237 |
Q |
| |
|
|||| |
|
|
| T |
47294295 |
tgct |
47294298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 90 - 165
Target Start/End: Original strand, 56043786 - 56043861
Alignment:
| Q |
90 |
attaaactaaagatgcagagcttgtaattagtttataattgcaggcaattgtttttctttgggtgtataatccaaa |
165 |
Q |
| |
|
|||||||| |||||||||| | |||||||||||||||||||||||||||||| | ||||||||||||| ||||| |
|
|
| T |
56043786 |
attaaactgaagatgcagaatgtataattagtttataattgcaggcaattgtttatgtttgggtgtataacccaaa |
56043861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University