View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12932_low_21 (Length: 241)
Name: NF12932_low_21
Description: NF12932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12932_low_21 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 16 - 241
Target Start/End: Original strand, 34353703 - 34353928
Alignment:
| Q |
16 |
catacaattacattacaattgtagaatgaaatcgagaatttacttattgtttttgttaacaagttttaggatttactagtttattaggataccatagttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34353703 |
catacaattacattacaattgtagaatgaaatcgagaatttacttattgtttttgttaacaagttttaggatttactagtttattaggataccatagttt |
34353802 |
T |
|
| Q |
116 |
tattttgtacttaagttaccaattacttttcacttgctttttcttcttctcttacatatgcctggctctacattatagagggatatgttttgggtgcatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34353803 |
tattttgtacttaagttaccaattacttttcacttgctttttcttcttctcttacatatgcctggctctacattatagagggatatgttttgtgtgcatt |
34353902 |
T |
|
| Q |
216 |
ttatttcgagcataacgacaaatatc |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
34353903 |
ttatttcgagcataacgacaaatatc |
34353928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University