View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12932_low_23 (Length: 225)
Name: NF12932_low_23
Description: NF12932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12932_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 45171031 - 45171245
Alignment:
| Q |
1 |
aagacaaatattcttcgacatccggataaaaaattaaacaactttcatagcaataaatggttatattaagactaatattgcagcagatttagctggatac |
100 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45171031 |
aagacaaatattggtcgatatccggataaaaaattaaacaactttcatagcaataaatggttatattaagactaatattgcagcagatttagctggatac |
45171130 |
T |
 |
| Q |
101 |
caacatgcaatgaaaaaatcttgtgaacaagaatgaacagaaataaatctacaagatgttagagcctagtggtgtttcgcagtgaggacgttttatgcgg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45171131 |
caacatgcaacgaaaaaatcttgtgaacaagaattaacagaaataaatctacaagatgttagagccta---gtgtttcgcagtgaggacgttttatgcgg |
45171227 |
T |
 |
| Q |
201 |
gtgtctgggtttgatcct |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45171228 |
gtgtctgggtttgatcct |
45171245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University