View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12933_high_5 (Length: 340)
Name: NF12933_high_5
Description: NF12933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12933_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 2 - 263
Target Start/End: Original strand, 17581908 - 17582161
Alignment:
| Q |
2 |
agcagaatcattgctaaccttcgtaacaaaaacaaatcactggtcatttgataaatatgccaagttagataattttatgatgactgatgagaggtctgtc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17581908 |
agcagaatcattgctaaccttcgtaacaaaaacaaatcactggt--------aaatatgctaagttagataattttatgatgactgatgagaggtctgtc |
17581999 |
T |
|
| Q |
102 |
cttgccttataattttattaggcaaggagttttcatcatcaaactgttacgattgactgtcggtatnnnnnnntgtttacagtgaaaggtatatctgaat |
201 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
17582000 |
cttgcctgataattttattaggcaaggagttttcatcatcaaactgttacgattgaccgtcgttataaaaaaatgtttacagtgaaaggtatatctgaat |
17582099 |
T |
|
| Q |
202 |
taaatcaaaataaaaaatgatggttcaagagtattgctttctcatccaatatggtaactgca |
263 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17582100 |
taaatcaaaataaaaaatgatagttcaagagttttgctttctcatccaatatggtaactgca |
17582161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 292 - 330
Target Start/End: Original strand, 17582163 - 17582201
Alignment:
| Q |
292 |
ccattttggaggttgcccctaagatagcacaggttctgc |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17582163 |
ccattttggaggttgcccctaagatagcacaagttctgc |
17582201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 177 - 322
Target Start/End: Complemental strand, 14745292 - 14745143
Alignment:
| Q |
177 |
tttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatggttcaagagtattgctttctcatccaat----atggtaactgcagtctagtct |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||| |||||||||| |
|
|
| T |
14745292 |
tttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatggttcaagagttttgctttctcatgcaatatgcatggtaactgtagtctagtct |
14745193 |
T |
|
| Q |
273 |
acctcacttgaaaagcaagccattttggaggttgcccctaagatagcaca |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14745192 |
acctcacttgaaaagcaagccattttggaggttgcccctaagatagcaca |
14745143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 158
Target Start/End: Original strand, 53896354 - 53896391
Alignment:
| Q |
121 |
aggcaaggagttttcatcatcaaactgttacgattgac |
158 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |
|
|
| T |
53896354 |
aggcaaggagttttcaccaacaaactgttacgattgac |
53896391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 181 - 209
Target Start/End: Original strand, 53896417 - 53896445
Alignment:
| Q |
181 |
cagtgaaaggtatatctgaattaaatcaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53896417 |
cagtgaaaggtatatctgaattaaatcaa |
53896445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University