View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12933_low_1 (Length: 480)
Name: NF12933_low_1
Description: NF12933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12933_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 7e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 7e-81
Query Start/End: Original strand, 65 - 233
Target Start/End: Complemental strand, 4295930 - 4295762
Alignment:
| Q |
65 |
taagtagatgactaacattttccactttcacacaacctctttaggataaaagtaagtgtgaatctaaaatacccctttaagctaagttatcatttgttgc |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4295930 |
taagtagatgactaacattttccactttcacacaacctctttagcataaaagtaagtgtgaatctaaaatacccctttaagctaagttatcatttgttat |
4295831 |
T |
|
| Q |
165 |
atccctgttgtttaaatgcctccaatcaaacaataaaacttttagaggaactacattgttccaaaatga |
233 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4295830 |
atccccgttgtttaaatgcctccaatcaaacaataaaacttttagaggaactacattgttccaaaatga |
4295762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 126 - 162
Target Start/End: Complemental strand, 22832918 - 22832882
Alignment:
| Q |
126 |
atctaaaatacccctttaagctaagttatcatttgtt |
162 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
22832918 |
atctaaaataccccattaaactaagttatcatttgtt |
22832882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University