View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12934_high_8 (Length: 232)
Name: NF12934_high_8
Description: NF12934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12934_high_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 56 - 232
Target Start/End: Original strand, 40440261 - 40440436
Alignment:
| Q |
56 |
ggtgtgtctggttatacaaatgtgagcaattcttccccttgaacgagatccctcaagaacctagggtttgcctagcatcgattcactttgatggtcttgc |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40440261 |
ggtgtgtctggttatacaaatgtgagcaattcttccccttggacgagatccctcaataacctagggttcgcctagcatcgattcactttgatggtcttgc |
40440360 |
T |
 |
| Q |
156 |
ccttcaatgacacttaaactacatgctggcaagatacaaatactcctccatggcaagagtacgctgatgaagacccc |
232 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40440361 |
ccttcaatgacacttaaactacatgcgggcaagatac-gatactcctccatggcaagagtatgctgatgaagacccc |
40440436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University