View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12934_high_9 (Length: 206)
Name: NF12934_high_9
Description: NF12934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12934_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 182
Target Start/End: Original strand, 42595054 - 42595219
Alignment:
| Q |
17 |
atatgcttaatgctttatacttattttagagtccaaatttgtagctacccaacatgattgaaataaacccatcaatattttgcaaatctgttggctatta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42595054 |
atatgcttaatgctttatacttattttagagttcaaatttgtagctacccaacatgattgaaataaacccatcaatattttgcaaatctgttggctatta |
42595153 |
T |
|
| Q |
117 |
aagaatataatgcgccacattggggatccattgtgaatgataattaggaaacataaatctgctggc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42595154 |
aagaatataatgcgccacattggggatccattgtgaatgataattaggaaacataaatctgctggc |
42595219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University