View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12934_low_10 (Length: 227)
Name: NF12934_low_10
Description: NF12934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12934_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 23145566 - 23145752
Alignment:
| Q |
1 |
gtggatcgattttcggtgttagctttagcctgcgtgtgtaagcagatcatgttctgttgtggccagtcttctgcattcagcaggtggtttcgagctaggc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23145566 |
gtggatcgattttcggtgttagccttagcctgcgtgtgtaagcagatcatgttctgttgtggccagtcttctgcattcagcaggtggtttcgagttaggc |
23145665 |
T |
|
| Q |
101 |
agtgtgattttggactgtggcggtgttttggagcatctttgggcctttgatatcttaggttttttgtctgagatgttagtttgggtg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
23145666 |
agtgtgattttggactgtggcggtgttttggagcatctttgggcctttgatatcttaggttttttggctgagatgttagttttggtg |
23145752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University