View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12934_low_7 (Length: 326)
Name: NF12934_low_7
Description: NF12934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12934_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 20 - 300
Target Start/End: Complemental strand, 6888015 - 6887735
Alignment:
| Q |
20 |
gaacatgaatctcgactacatttgtactggatgaaccgatatcgatgtctagactgcgtgaatgcgagaaattgttgattgcatggaataaagtgagata |
119 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6888015 |
gaacatgaatctcgacgacatttgttcttgatgaaccgatatcgatgtctaaactgcgtgaatgcgagaaattgttgattgcatggaataaagtgagata |
6887916 |
T |
 |
| Q |
120 |
gctcatttccctatccactacttcactgacattctatcagacagaaaataaactaactcaagaaatcactgattgagcttttcacatccgcataaagtca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6887915 |
gctcatttccctatccactacttcactgacattctatcagacagaaaataaactaactcaagaaatcactgattgagcttttcacatccgcataaagtca |
6887816 |
T |
 |
| Q |
220 |
gatacatcccaacattgattcccttttcctttgtaattattctatcactcaaatccataagcttcacttcactctttcacc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6887815 |
gatacatcccaacattgattcccttttcctttgtaattattctatcactcaaatccataagcttcacttcactctttcacc |
6887735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University