View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12935_low_27 (Length: 216)
Name: NF12935_low_27
Description: NF12935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12935_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 13700190 - 13700023
Alignment:
| Q |
1 |
tagcttcataccagaatctctttggtacatctctaccagagaacatgcttctcaccatgttcatcattgttttcttctttaattttgagattccattcaa |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13700190 |
tagcttcatactagaatctctttggtacatctctaccagagaacatgcttctcactatgttcatcattgttttcttctttaattttgagattccattcaa |
13700091 |
T |
 |
| Q |
101 |
acatggagattaagttgtcttttaaaccatgcaagctccaaaattcattaaagaatatataactgaat |
168 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13700090 |
acatggagattaagttttcttttaaaccatgcaagctccaaaattcattaaagaatatataactgaat |
13700023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 3 - 168
Target Start/End: Complemental strand, 17390178 - 17390014
Alignment:
| Q |
3 |
gcttcataccagaatctctttggtacatctctaccagagaacatgcttctcaccatgttcatcattgttttcttctttaattttgagattccattcaaac |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| | | |
|
|
| T |
17390178 |
gcttcataccagaaactctttggtacatctctactagagaacatgcttctcaccatgttcttcattgttttcttctttcattttgagattccattctacc |
17390079 |
T |
 |
| Q |
103 |
atggagattaagttgtcttttaaaccatgcaagctccaaaattcattaaagaatatataactgaat |
168 |
Q |
| |
|
||| || |||||| ||||||||||||||||||| | |||||||||||||||| |||||| ||||| |
|
|
| T |
17390078 |
atgaagtttaagtggtcttttaaaccatgcaag-ttcaaaattcattaaagacaatataagtgaat |
17390014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University