View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12936_high_10 (Length: 310)
Name: NF12936_high_10
Description: NF12936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12936_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 53 - 302
Target Start/End: Complemental strand, 14610271 - 14610020
Alignment:
| Q |
53 |
cttacagtacagatgatgggtagttaaggttgagattctatgatgagaagtggttgttcaaacttagttatgcaccaagaaggtagcnnnnnnnnnnnnn |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14610271 |
cttacagtacagatgatgggtagttaaggttgagattctatgatgagaagtggttgttcaaacttagttatgcaccaagaaggtagcagagagagagaga |
14610172 |
T |
|
| Q |
153 |
n--tgtagtagaagaaagatgatagttttgcttttttgaaaggaaaaagagaaggaaaagagaataccgccccagtcctggtccctcaactggtggttta |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14610171 |
gagtgtagtagaagaaagatgatagttttgcttttttgaaaggaaaaagagaaggaaaagagaataccgccccagtcctggtccctcaactggtggttta |
14610072 |
T |
|
| Q |
251 |
gtgttattaacgttttcagctgtattttattatattctttcgaattcatctc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14610071 |
gtgttattaacgttttcagctgtattttattatattctttcgaattcgtctc |
14610020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University