View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12936_high_22 (Length: 224)

Name: NF12936_high_22
Description: NF12936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12936_high_22
NF12936_high_22
[»] chr1 (1 HSPs)
chr1 (1-224)||(51367758-51367981)


Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 51367981 - 51367758
Alignment:
1 ccagctacgatttttggaatgacaccggggacaatgttcgtgatgagagttttgatttccgcaacaaagctaagctagaggatccaccgtcgcaactaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51367981 ccagctacgatttttggaatgacaccggggacaatgttcgtgatgagagttttgatttccgcaacaaagctaagctagaggatccaccgtcgcaactaat 51367882  T
101 cggaaaatttcttcataaacagcgtgcctccggtgatatgttgttggatatggatttggagatggaagagctgcagaatgaaggtaatggcgctgacgga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51367881 cggaaaatttcttcataaacagcgtgcctccggtgatatgttgttggatatggatttggagatggaagagctgcagaatgaaggtaatggcgctgacgga 51367782  T
201 aagttaacgccggttgaggaatct 224  Q
    ||||||||||||||||||||||||    
51367781 aagttaacgccggttgaggaatct 51367758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University