View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12936_high_22 (Length: 224)
Name: NF12936_high_22
Description: NF12936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12936_high_22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 51367981 - 51367758
Alignment:
| Q |
1 |
ccagctacgatttttggaatgacaccggggacaatgttcgtgatgagagttttgatttccgcaacaaagctaagctagaggatccaccgtcgcaactaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367981 |
ccagctacgatttttggaatgacaccggggacaatgttcgtgatgagagttttgatttccgcaacaaagctaagctagaggatccaccgtcgcaactaat |
51367882 |
T |
 |
| Q |
101 |
cggaaaatttcttcataaacagcgtgcctccggtgatatgttgttggatatggatttggagatggaagagctgcagaatgaaggtaatggcgctgacgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367881 |
cggaaaatttcttcataaacagcgtgcctccggtgatatgttgttggatatggatttggagatggaagagctgcagaatgaaggtaatggcgctgacgga |
51367782 |
T |
 |
| Q |
201 |
aagttaacgccggttgaggaatct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
51367781 |
aagttaacgccggttgaggaatct |
51367758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University