View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12936_low_14 (Length: 303)
Name: NF12936_low_14
Description: NF12936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12936_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 19 - 298
Target Start/End: Complemental strand, 54878454 - 54878175
Alignment:
| Q |
19 |
ttcaactgtttcttctttctttgtgcgtgaaattgcggcgttgatggataaacggtgggttttggaaatgggtctatgtttgtatgatgtgggtgggttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54878454 |
ttcaactgtttcttctttctttgtgcgtgaaattgcggcgttgatggataaacggtgggttttggaaatgggtctatgtttgtatgatgtgggtgggttg |
54878355 |
T |
|
| Q |
119 |
aatgggttaatgggtcgggttaggatttgaaaagattgggttttggtggatggaagagagaagctgagtagagttgcagtagcttccatggtgatgatgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54878354 |
aatgggttaatgggtcgggttaggatttgaaaagattgggttttggtggatggaagagagaagctgagtagagttgcagtagcttccatggtgatgatgg |
54878255 |
T |
|
| Q |
219 |
aaatggaagatgaagaaaactgaaaatgggataaaagggttggtttgattcatattggcttatcttatccctttgcttct |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54878254 |
aaatggaagatgaagaaaactgaaaatgggataaaagggttggtttgattcatattggcttatcttatccctttgtttct |
54878175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University