View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12936_low_20 (Length: 263)
Name: NF12936_low_20
Description: NF12936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12936_low_20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 263
Target Start/End: Complemental strand, 49768606 - 49768355
Alignment:
| Q |
13 |
cacagacacaaaacaacaactcaagttagtactgcgtt-gaaacatttacacagacacggaatttgtttataatttaagaaaatgtcctatcttaatcta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
49768606 |
cacagacacaaaacaacaactcaagttagtactgcgttagaaacatttacacagacacggaatttgtttataatttaagaaaatgtcctatcttaatcaa |
49768507 |
T |
 |
| Q |
112 |
cgcaataaacatgcattcaatttgaaatgtcggtgctagataggttggtggcatacataccgatcaatgcgttgtcttaacttcaacaagaacttctcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49768506 |
cgcaataaacatgcattcaatttgaaatgtcggtgctagataagttggtagcatacataccgatcaatgcgttgtcttaacttcaacaagaacttctcat |
49768407 |
T |
 |
| Q |
212 |
tatcttcctcggcaatcttgacaagtctctccactaaattctttctctgcag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49768406 |
tatcttcctcggcaatcttgacaagtctctccactaaattcttcctctgcag |
49768355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 14 - 45
Target Start/End: Original strand, 3829636 - 3829667
Alignment:
| Q |
14 |
acagacacaaaacaacaactcaagttagtact |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3829636 |
acagacacaaaacaacaactcaagttagtact |
3829667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University