View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12936_low_29 (Length: 214)
Name: NF12936_low_29
Description: NF12936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12936_low_29 |
 |  |
|
| [»] scaffold0008 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 33 - 151
Target Start/End: Complemental strand, 65556 - 65438
Alignment:
| Q |
33 |
cttaacaaaaatggatacatatcttagtcactttatgacacgatttgaaaataaaaacttccttatttgttagctctgaatctgttttaatctgattcct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
65556 |
cttaacaaaaatggatacatatcttagtcactttatgacacgatttgaaaataagaacttccttatttgttagcactgaatctgttttaatctgattcct |
65457 |
T |
 |
| Q |
133 |
ctaaaagatcctcttagaa |
151 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
65456 |
ctaaaagatcctcttagaa |
65438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 33 - 151
Target Start/End: Complemental strand, 73399 - 73281
Alignment:
| Q |
33 |
cttaacaaaaatggatacatatcttagtcactttatgacacgatttgaaaataaaaacttccttatttgttagctctgaatctgttttaatctgattcct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
73399 |
cttaacaaaaatggatacatatcttagtcactttatgacacgatttgaaaataagaacttccttatttgttagcactgaatctgttttaatctgattcct |
73300 |
T |
 |
| Q |
133 |
ctaaaagatcctcttagaa |
151 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
73299 |
ctaaaagatcctcttagaa |
73281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University