View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12937_low_10 (Length: 237)
Name: NF12937_low_10
Description: NF12937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12937_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 36462412 - 36462192
Alignment:
| Q |
1 |
cgcttgttagccgtccggccttgtctcacatggaggtgaaaacgagaatggttgcgaggttaaagcatttgggaattaatgtgaaaagggtattggaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36462412 |
cgcttgttagccgtccggccttgtctcacacggaggtgaaaacgagaatggttgcaaggttaaagcatttgggaattaatgtgaaaagggtattggaaga |
36462313 |
T |
|
| Q |
101 |
tgagaagggcttgattccaatgggagggcctttaccaagaatgcctcaaaatgtgattgcatttggtgcaaattctggtgtagttcatccttctactgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36462312 |
tgagaagggcttgattccaatgggaggacctttaccaagaatacctcaaaatgtgattgcatttggtgcaaattctggtgtagttcatccttctactgga |
36462213 |
T |
|
| Q |
201 |
tacatgatggctagaactatg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36462212 |
tacatgatggctagaactatg |
36462192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 36456177 - 36456393
Alignment:
| Q |
1 |
cgcttgttagccgtccggccttgtctcacatggaggtgaaaacgagaatggttgcgaggttaaagcatttgggaattaatgtgaaaagggtattggaaga |
100 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||| ||||| | ||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36456177 |
cgcttgttagtcgtccggttttgtcttacatggatgtgaagagaagaatggttgcaaggttaaggcatttgggaattaatgtgaagagggtattggaaga |
36456276 |
T |
|
| Q |
101 |
tgagaagggcttgattccaatgggagggcctttaccaagaatgcctcaaaatgtgattgcatttggtgcaaattctggtgtagttcatccttctactgga |
200 |
Q |
| |
|
||| ||| | ||||||||||||||||| ||||||||||| || ||||||||||||| ||||||||| |||||||||| ||||||||||||| |||||| |
|
|
| T |
36456277 |
tgaaaagtgtttgattccaatgggaggacctttaccaaggatatctcaaaatgtgatgccatttggtggaaattctggtatagttcatccttcaactgga |
36456376 |
T |
|
| Q |
201 |
tacatgatggctagaac |
217 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
36456377 |
tacatggtggctagaac |
36456393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University