View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12937_low_6 (Length: 298)
Name: NF12937_low_6
Description: NF12937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12937_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 278
Target Start/End: Complemental strand, 47126964 - 47126704
Alignment:
| Q |
18 |
atgaagacaagaatcgatctcatacaatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126964 |
atgaagacaagaatcgatctcatacaatcttgcaccattattatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcag |
47126865 |
T |
 |
| Q |
118 |
gttacctaccaaatcgtccaacggttagtcgtaggtttatgcctgagcaaggtacaccagagtatgaagagcttgagtcagatcctgaattagcattctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126864 |
gttacctaccaaatcgtccaacggttagtcgtaggtttatgcctgagcaaggtacaccagagtatgaagagcttgagtcagatcctgaattagcattctt |
47126765 |
T |
 |
| Q |
218 |
aaaaacaatcacagctcagttccaaactcttcttggtgtgtcattgatagaagttctgtct |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126764 |
aaaaacaatcacagctcagttccaaactcttcttggtgtgtcattgatagaagttctgtct |
47126704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 52 - 121
Target Start/End: Original strand, 9606270 - 9606339
Alignment:
| Q |
52 |
ccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcaggtta |
121 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| || ||||||||||| ||||||| |||||| |
|
|
| T |
9606270 |
ccattatcatatggactgcttctgctcttcatgcagctgttaattttggacaatatccttatggaggtta |
9606339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 60 - 139
Target Start/End: Complemental strand, 46709234 - 46709155
Alignment:
| Q |
60 |
atatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatgcaggttacctaccaaatcgtccaac |
139 |
Q |
| |
|
|||||| | ||||| ||| | ||||||||||| |||||||||||||| |||| |||||||||| |||||| |||||||| |
|
|
| T |
46709234 |
atatggattgcttcagctctacatgcagctgtaaactttggacaatatccttttgcaggttactcaccaaaccgtccaac |
46709155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 42 - 114
Target Start/End: Complemental strand, 6456223 - 6456151
Alignment:
| Q |
42 |
caatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaatacccttatg |
114 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||| |||||||||| || ||||||||||| || ||||||| |
|
|
| T |
6456223 |
caatcttgctccattatcatatggactgcttcagctcttcatgcagcagttaactttggacagtatccttatg |
6456151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 42 - 112
Target Start/End: Complemental strand, 6449756 - 6449686
Alignment:
| Q |
42 |
caatcttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaataccctta |
112 |
Q |
| |
|
||||||||| ||||||| |||||| ||||||||| ||||||||||||| || || |||||||| ||||| |
|
|
| T |
6449756 |
caatcttgctccattattatatggactgcttctgctcttcatgcagctgttaatttcggacaatatcctta |
6449686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 106
Target Start/End: Complemental strand, 7458044 - 7457984
Alignment:
| Q |
46 |
cttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaata |
106 |
Q |
| |
|
||||||||||| |||||||| | ||||| || ||||||||||||| || ||||||||||| |
|
|
| T |
7458044 |
cttgcaccattctcatatggattgcttcagcacttcatgcagctgttaattttggacaata |
7457984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 106
Target Start/End: Complemental strand, 7470446 - 7470386
Alignment:
| Q |
46 |
cttgcaccattatcatatgggtggcttctgcttttcatgcagctgtgaactttggacaata |
106 |
Q |
| |
|
||||||||||| |||||||| | ||||| || ||||||||||||| || ||||||||||| |
|
|
| T |
7470446 |
cttgcaccattctcatatggattgcttcagcacttcatgcagctgttaattttggacaata |
7470386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University