View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12937_low_7 (Length: 268)
Name: NF12937_low_7
Description: NF12937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12937_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 38919588 - 38919835
Alignment:
| Q |
1 |
aagaggtgttgtagtggtgagtgccatgttggtaagttagtgaaggagaattaagatttgaagatgaggtttggtgagtatgtggagaggtggagagggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38919588 |
aagaggtgttgtagtggtgagtgccatgttggtaagttagtgaaggagaattaagatttgaagatgaggtttggtgagtatgtggagaggtggagagggg |
38919687 |
T |
|
| Q |
101 |
ttttatttggagaggaatattattaataaggtaatttggttgagaatttgttggcatgagctggatcaaggctagcatatatcaatatattcccttagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38919688 |
ttttatttggagaggaatattattaataaggtaatttggttgagaatttgttggcatgagctggatcaaggctagcatatatcaatatattcccttagtt |
38919787 |
T |
|
| Q |
201 |
gacaaatgaatacaaaaataaatcacatcaaagttgcaataaggaatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38919788 |
gacaaatgaatacaaaaataaatcacatcaaagttgcaataaggaatg |
38919835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University