View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12937_low_8 (Length: 248)
Name: NF12937_low_8
Description: NF12937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12937_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 24 - 243
Target Start/End: Complemental strand, 29449232 - 29449014
Alignment:
| Q |
24 |
ttgggcacaaagggatggcattcaaagtctacagcagaaaaggattaagagtccaccttatgatattacaacataaaacttaatttgtagaaaaaatatt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29449232 |
ttgggcacaaagggatggcattcaaagtctacagcataaaaggattaagagtccaccttatgatattacaacataaaacttaatttgtagaaaaaatatt |
29449133 |
T |
|
| Q |
124 |
caagacatgattnnnnnnnngggcgtttttgtgtgaaaatgccttgtaggtttcttttgcaagtacatatttgtgaagtgtagtttcttgtattagattt |
223 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29449132 |
caagacatgatt-aaaaaaagggcgtttttgtgtgaaaatgccttgtaggtttcttttgcaagtacatatttgtgaagtgtagtttcttgtattagattt |
29449034 |
T |
|
| Q |
224 |
tgtgtagtacctttgcttct |
243 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29449033 |
tgtgtagtacctttgcttct |
29449014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 53 - 122
Target Start/End: Complemental strand, 29457149 - 29457080
Alignment:
| Q |
53 |
tacagcagaaaaggattaagagtccaccttatgatattacaacataaaacttaatttgtagaaaaaatat |
122 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
29457149 |
tacagcagaaaaggaataatagtccacattatgatattacaacataaaacataccttgtagaaaaaatat |
29457080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 195
Target Start/End: Complemental strand, 29457031 - 29456984
Alignment:
| Q |
148 |
gtttttgtgtgaaaatgccttgtaggtttcttttgcaagtacatattt |
195 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| |||||| |||| |
|
|
| T |
29457031 |
gtttttgtgtgaaaatactttgtaggtttcttttgcgagtacaaattt |
29456984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University