View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12938_low_6 (Length: 245)
Name: NF12938_low_6
Description: NF12938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12938_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 32 - 230
Target Start/End: Complemental strand, 38721114 - 38720916
Alignment:
| Q |
32 |
ggacaacaatatgaaaatgatttacattgagatcccctctggaaaagatattgtgggggaaataatcaattgtgctcagcgttatcaagctagcataaca |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38721114 |
ggacaacaatatgaaaatgatttacattgagatcccctctggaaaagatattgtgggggaaataatcaattgtgctcatcgttatcaagctagcataaca |
38721015 |
T |
|
| Q |
132 |
gtgtcgaggggttacggtcttgtcaccaatgttacccttctcaatcctgaaactcatttcccaactcctcctatgatagggccatttgagatgacatct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38721014 |
gtgtcgaggggttacggtcttgtcaccaatgttacccttctcaatcctaaaactcatttcccaactcctcctatgatagggccatttgagatgacatct |
38720916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University