View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12939_high_4 (Length: 326)
Name: NF12939_high_4
Description: NF12939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12939_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 256 - 307
Target Start/End: Original strand, 40006145 - 40006197
Alignment:
| Q |
256 |
cttgatagtttattatcatattgtttctaggc-aaaaagaggtttgagtaggt |
307 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
40006145 |
cttgatagtttattatcatcttgtttctaggcaaaaaagaggtttgagtaggt |
40006197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 135 - 173
Target Start/End: Original strand, 40006026 - 40006064
Alignment:
| Q |
135 |
gttaattgggatcaagaaaaatatttcccatttcttaga |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40006026 |
gttaattgggatcaagaaaaatatttcccatttcttaga |
40006064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University