View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1293_high_29 (Length: 320)
Name: NF1293_high_29
Description: NF1293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1293_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 39136877 - 39137182
Alignment:
| Q |
1 |
tttcggtgaagtgagagccgttcaaacggcctcatcccgtaacggagtcataactgctcattcctatgatcttagacacgcagagacggcgtttgccgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39136877 |
tttcggtgaagtgagagccgttcaaacggactcattccgtaacggagtcataactgctcattactatgatcttagacacgcagagacggcgtttgccgct |
39136976 |
T |
 |
| Q |
101 |
attcggactcatcacgtcctctgtggtgcctatttcaaccctctatcttattcccaaattttccccacgccactacctccgccgccgccgggtctcgtcg |
200 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39136977 |
attcggactcatcacgtcctctgcgctgcctatttcaaccctctatcttattcccaaattttccccacgccactacctccgccgccaccgggtctcgtcg |
39137076 |
T |
 |
| Q |
201 |
ccggtgcaccgttgtgggcccattatgtactctccgatgctcagaatcaaggaaccctagttgttttcaacttagatgacgacgtttcttctgatcagct |
300 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39137077 |
ccggtgcaccgctgtgggcccattatgtactctccgatgctcagaatcaaggaaccctagttgttttcaacttagatgacgacgtttcttctgatcagct |
39137176 |
T |
 |
| Q |
301 |
gcaaca |
306 |
Q |
| |
|
|||||| |
|
|
| T |
39137177 |
gcaaca |
39137182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University