View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1293_high_30 (Length: 316)
Name: NF1293_high_30
Description: NF1293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1293_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 30 - 308
Target Start/End: Original strand, 48523332 - 48523610
Alignment:
| Q |
30 |
gacgacatggatggtgtagcatatacaagcaacaatgaaattcatttgagtgcaaggtatgttaatagctatggtggtgatttgagaaaggagattacag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48523332 |
gacgacatggatggtgtagcatatacaagcaacaatgaaattcatttgagtgcaaggtatgttaatagctatgggggtgatttgagaaaggagattacag |
48523431 |
T |
|
| Q |
130 |
gggtattgtatcatgaaatgactcatgtatggcagtggaatggtaatggacaagctaatggtggattaattgaaggtatagcagattatgtaagattgaa |
229 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48523432 |
gggtattgtatcatgaaatgacacatgtatggcagtggaatggtaatggtcaagctaatggtggattaattgaaggtatagcagattatgtaagattgaa |
48523531 |
T |
|
| Q |
230 |
agctaattatgcaccaagtcattgggtcaaaccagggcaaggaaataagtgggaccaaggttatgatgcaacagctagg |
308 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
48523532 |
agctaattatgcacctagtcattgggtcaaaccagggcaaggaaataagtgggaccaaggttatgatgtaactgctagg |
48523610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University