View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1293_high_38 (Length: 251)
Name: NF1293_high_38
Description: NF1293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1293_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 5665306 - 5665546
Alignment:
| Q |
1 |
gagaggtttggtacaaaggagaggataaggggttatttttcgggagcagacggatatagctgcctaaagggagcaatagattgaggaggaggactttgac |
100 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665306 |
gagaggtttggtacaaagaagagggtaaggggttatttt-cgggagcagacagatatagctgcctaaagggagcaatagattgaggaggaggactttgac |
5665404 |
T |
 |
| Q |
101 |
cagggaaaggaggaggagttcgacaatatcatggtcgaccagcatgacacttccgggtttggcccaaattttatgtgattatgcacttttcttatcacta |
200 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665405 |
catggaaaggaggaggagtttgacaatatcatggtcgaccagcatgacacttccgggtttggcccaaattttatgtgattatgcacttttcttatcacta |
5665504 |
T |
 |
| Q |
201 |
atgtagttgtttttattttcatgtagttgttctaagaataat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5665505 |
atgtagttgtttttattttcatgtagttgttctaaaaataat |
5665546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University