View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1293_high_45 (Length: 216)

Name: NF1293_high_45
Description: NF1293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1293_high_45
NF1293_high_45
[»] chr1 (2 HSPs)
chr1 (2-77)||(8006400-8006475)
chr1 (53-120)||(8006476-8006543)


Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 2 - 77
Target Start/End: Original strand, 8006400 - 8006475
Alignment:
2 attagaatttagaaattttcaaagtataatcacttatcgcaaatttacaaaatttatatgctccctgataacatag 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8006400 attagaatttagaaattttcaaagtataatcacttatcgcaaatttacaaaatttatatgctccctgataacatag 8006475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 53 - 120
Target Start/End: Original strand, 8006476 - 8006543
Alignment:
53 atttatatgctccctgataacatagttaaaaataaataaattactcaaaactgaagtatcacaagtat 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8006476 atttatatgctccctgataacatagttaaaaataaataaattactcaaaactgaagtatcacaagtat 8006543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University