View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1293_high_45 (Length: 216)
Name: NF1293_high_45
Description: NF1293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1293_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 2 - 77
Target Start/End: Original strand, 8006400 - 8006475
Alignment:
| Q |
2 |
attagaatttagaaattttcaaagtataatcacttatcgcaaatttacaaaatttatatgctccctgataacatag |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8006400 |
attagaatttagaaattttcaaagtataatcacttatcgcaaatttacaaaatttatatgctccctgataacatag |
8006475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 53 - 120
Target Start/End: Original strand, 8006476 - 8006543
Alignment:
| Q |
53 |
atttatatgctccctgataacatagttaaaaataaataaattactcaaaactgaagtatcacaagtat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8006476 |
atttatatgctccctgataacatagttaaaaataaataaattactcaaaactgaagtatcacaagtat |
8006543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University